Skip to main content

Table 1 Utilized primers and TaqMan probes in the present research

From: Association between colorectal cancer and Fusobacterium nucleatum and Bacteroides fragilis bacteria in Iranian patients: a preliminary study

Target bacteria Primer/Probe Oligonucleotide sequence (50e30) Size (bp) Product size (bp) Ref
Streptococcus gallolyticus subsp. gallolyticus Primer F
Primer R
Probe
CAGAAATTGGAGAGGATTTGGAAG
CCGTTATTAATCACCGCTTGAC
ATATCTGCTGGAATACTGTCAACATCTGCC
24
22
30
85 This study
EPEC Primer F
Primer R
Probe
AGACTACAGGAAAATCGCTTGTTAGC
CGTCCCTTTGATTCCAGTTCC
TTCAACATTACCGTCATCAATAGCAAGTGG
26
21
30
140 This study
Fusobacterium nucleatum Primer F
Primer R
Probe
AGCTACAAGAGAAGAAAATGAAAATGG
CCAACTCCTACAAATCCAGTAACC
TTACTTCATACCATACACGAGGATCTACTT
27
24
30
105 This study
Bacteroides fragilis Primer F
Primer R
Probe
CGAGGGGCATCAGGAAGAA
CGGAATCATTATGCTATCGGGTA
CTTGCTTTCTTTGCTGGCGACCG
19
23
23
136 [18]
SLCO2A1 Primer F
Primer R
Probe
GAGAGATTTGAATGTTGGACAAAGC
ACACTTCTGTGGTCACTCGTC
TCCTACTGCCATCCTTCTACCTGCCA
25
21
26
89 This study